Synthetic West Nile Virus RNA
VR-3274SD ™
Scheduled maintenance: Friday, May 17 9:00 p.m. to Saturday, May 18, 12:00 p.m. Eastern. Browse atcc.org may have interruptions. We apologize for any inconvenience.
VR-3274SD ™
Shipped in a proprietary stabilization matrix
ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.
Manufactured under ISO 13485 guidance
RNA is easily degraded. Take extra precautions against contamination by using new gloves and clean lab coats when working with RNA. Use only RNase-free lab materials when handling this product. Vortexing can damage the synthetic RNA. Gentle pipetting is highly recommended. Aliquoting is highly recommended to avoid multiple freeze-thaws, which can damage the synthetic RNA.
The following primers and probe can be used with this nucleic acid preparation.
Forward Primer (5’ to 3’): CAGACCACGCTACGGCG
Reverse Primer (5’ to 3’): CTAGGGCCGCGTGGG
Probe (5’ to 3’): 56-FAM/TCTGCGGAGAGTGCAGTCTGCGAT/3BHQ_1
The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent.
The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid. Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.
While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.
This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.
Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.
If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.
Lanciotti R, et al. Rapid detection of west nile virus from human clinical specimens, field-collected mosquitos, and avian samples by a TaqMan reverse transcriptase-PCR assay. J Clin Microbiol 38(11): 4066-4071, 2000 PubMed: 11060069
Eiden M, et al. Two new real-time quantitative reverse transcription polymerase chain reaction assays with unique target sites for the specific and sensitive detection of lineages 1 and 2 West Nile virus strains. J Vet Diagn Invest 22(5): 748-753, 2010 PubMed: 20807934
shukla J, et al. Molecular detection and characterization of West Nile virus associated with multifocal retinitis in patients from southern India. Int J Infect Dis 16(1): e53-e59, 2012. PubMed: 22099888
Barros SC, et al. Simultaneous detection of West Nile and Japanese encephalitis virus RNA by duplex TaqMan RT-PCR. J Virol Methods 193(2): 554-557, 2013. PubMed: 23892127
Shi P, et al. High-throughput detection of West Nile virus RNA. J Clin Microbiol 39(4): 1264-1271, 2001 PubMed: 11283039